Skip to content

Biologia molekularna i wczesne wykrywanie raka pęcherza – przypadek Huberta H. Humphreya ad

2 miesiące ago

469 words

Humphrey był następnie obserwowany z cystoskopią co sześć miesięcy13. Biopsja ujawniła raka in situ w 1969 roku, ale był bezobjawowy aż do czterech lat później. W 1973 r. Biopsja jego cewki moczowej wykazała złośliwość graniczną (in situ, komórka przejściowa z niewielkim ogniskiem prawdopodobnego raka mikroinwazyjnego), za którą otrzymywał zarówno radioterapię, jak i tiotepapinę dojelitową. W sierpniu 1976 r. Rozwinęło się nawracające krwiomocz, a biopsja doprowadziła do rozpoznania naciekającego raka pęcherza moczowego. Wykonano radykalną cystektomię, ujawniając szeroko naciekający rak komórek przejściowych pęcherza z przerzutami do węzłów chłonnych.16,18,19. Humphrey zmarł na raka 13 stycznia 1978 roku. Metody
Za zgodą wdowy Humphreya uzyskaliśmy utrwalone w formalinie, zatopione w parafinie bloki tkanek naciekającego raka pęcherza moczowego wyciętego z Humphrey w 1976 roku i przebadano raka pod kątem mutacji w genie supresorowym p5320. Sekcje pięciu mikrometrów tego pierwotnego raka mikrosadzono do wzbogacenia komórek nowotworowych, a eksony 5 do 9 genu p53 zamplifikowano za pomocą PCR12. Produkty PCR następnie izolowano i subklonowano do bakteriofagów i zsekwencjonowano ponad 500 połączonych klonów, 12 ujawniając przejście z adeniny do tyminy w kodonie 227 genu p53 w pierwotnym raku.
Następnie uzyskaliśmy dwa filtry barwione Papanicolaou (Millipore, Bedford, Mass.), Które przygotowano z moczem Humphreya, kiedy zaprezentowano go w maju 1967 roku. Wyizolowaliśmy DNA z tych filtrów i zamplifikowano przez PCR region obejmujący 104 par zasad. kodon 227 genu p53. Startery amplifikacji dla tej części egzonu 7 genu p53 były 5 GTAGGAATTCCAAGGCGCACTGGCCTC3 i 5 AGGAATTCTTACACATGTAGTTGTAGTGG3 . Warunki PCR i metody zastosowane do klonowania w lambda Zap (Strategene, La Jolla, CA) wykonano jak opisano wcześniej12. Następnie sklonowaliśmy produkty PCR do wektora bakteriofagowego, przenieśliśmy je na membrany nylonowe i hybrydyzowaliśmy je z sondą oligonukleotydową znakowaną 32P (5 GTTGGCTCAGACTGTACC3 ) specyficzną dla mutacji kodonu 227 znalezionej w resekcji pierwotnego raka12.
Wyniki
Ryc. 2. Ryc. 2. Autoradiografy próbek nowotworowych i moczowych. Panel A pokazuje autoradiografię żelu sekwencjonowania wykazującego transwersję A-to-T (antysensowną) w kodonie 227 (strzałka) genu p53 w pierwotnym raku pęcherza moczowego Humphrey a. Pasmo resztkowe w pierwszej linii pochodzi z nienowotworowego DNA typu dzikiego. Panel B pokazuje autoradiografy blaszek bakteriofagów zhybrydyzowanych do specyficznych oligomerów p53. Wiele hybrydyzujących łysinek zaobserwowano, gdy klonowany DNA z moczu Humphrey ego sondowano oligomerem p53 typu dzikiego. Mniejsza, ale godna uwagi liczba płytek z DNA w moczu hybrydyzowała ze zmutowanym specyficznym dla kodonu 227 oligomerem, ale nie kontrolowała DNA bez mutacji p53.
Zarówno inwazyjny rak pęcherza moczowego wycięty w 1976 r., Jak i filtry przygotowane z moczu w 1967 r. Analizowano pod kątem mutacji p53. Sekwencjonowanie połączonych klonów DNA z nowotworu wyciętego w 1976 ujawniło przejście z adeniny do tyminy w kodonie 227 genu p53 (Figura 2A)
[patrz też: zespół reitera, zatrzymanie pracy nerek, rdzeniowy zanik miesni ]

0 thoughts on “Biologia molekularna i wczesne wykrywanie raka pęcherza – przypadek Huberta H. Humphreya ad”

Powiązane tematy z artykułem: rdzeniowy zanik miesni zatrzymanie pracy nerek zespół reitera